Expression of aryl hydrocarbon receptor mRNA in porcine retina

A. K. Singh, Minoru Ko, H. Shichi

Research output: Contribution to journalArticle

Abstract

Purpose. The aryl hydrocarbon receptor (AHR) mediates CYP1A1/1A2 induction by aryl hydrocarbons (e.g. TCDD). AHR proteins are similar to steroid receptors in their mechanism of action but constitute a distinct molecular family (1). In addition to a role in drug metabolism, it was suggested that AHR may regulate the homeostasis and cell differentiation (2). Two Drosophila proteins Sim and Per which are homologous to AHR appear to play roles in neural development and circadian rhythm, respectively. AHR may also have a function in mammalian retina. In this study, therefore, we investigated whether AHR mRNA is expressed in porcine retina. Methods. cDNA was synthesized from porcine retina RNA by RT-PCR using primers designed from mouse AHR cDNA and cloned into pCRTM II vector. DNA was sequenced with SP6 and T7 primers and analyzed by NCBI BLAST Search. Results. From a comparison of 341 bases, the porcine retina PCR product was found to be very similar to AHR from several species [rat (R), mouse (M), human (H), sheep (S)]. Hog: ACATAACGGACGAAATCCTGACCCGGTTGCAGAA R: -------A--------------GTACG-----G- (- , identical residue) M: -------G---------------TACG-----G-Hog: GTCATAGCTATTCTGTGTGAATGTATATACATTCACACAGAATAGCTATGAC H: ---------G------------------------------------------S: ------------------------------------------C---------Conclusions. AHR message is expressed in porcine retina. In the eye CYP1A1/1A2 induction is highest in the ciliary epithelium and negligible in the retina (3). Then, the question is: What is AHR doing in the retina?.

Original languageEnglish
JournalInvestigative Ophthalmology and Visual Science
Volume37
Issue number3
Publication statusPublished - 1996 Feb 15
Externally publishedYes

Fingerprint

Aryl Hydrocarbon Receptors
Retina
Swine
Messenger RNA
Cytochrome P-450 CYP1A1
Complementary DNA
Polymerase Chain Reaction
Steroid Receptors
Hydrocarbons
Circadian Rhythm
Cell Differentiation
Sheep
Homeostasis
Epithelium
RNA

ASJC Scopus subject areas

  • Ophthalmology

Cite this

Expression of aryl hydrocarbon receptor mRNA in porcine retina. / Singh, A. K.; Ko, Minoru; Shichi, H.

In: Investigative Ophthalmology and Visual Science, Vol. 37, No. 3, 15.02.1996.

Research output: Contribution to journalArticle

@article{f53d7fecb8444baeb596e12832b0602f,
title = "Expression of aryl hydrocarbon receptor mRNA in porcine retina",
abstract = "Purpose. The aryl hydrocarbon receptor (AHR) mediates CYP1A1/1A2 induction by aryl hydrocarbons (e.g. TCDD). AHR proteins are similar to steroid receptors in their mechanism of action but constitute a distinct molecular family (1). In addition to a role in drug metabolism, it was suggested that AHR may regulate the homeostasis and cell differentiation (2). Two Drosophila proteins Sim and Per which are homologous to AHR appear to play roles in neural development and circadian rhythm, respectively. AHR may also have a function in mammalian retina. In this study, therefore, we investigated whether AHR mRNA is expressed in porcine retina. Methods. cDNA was synthesized from porcine retina RNA by RT-PCR using primers designed from mouse AHR cDNA and cloned into pCRTM II vector. DNA was sequenced with SP6 and T7 primers and analyzed by NCBI BLAST Search. Results. From a comparison of 341 bases, the porcine retina PCR product was found to be very similar to AHR from several species [rat (R), mouse (M), human (H), sheep (S)]. Hog: ACATAACGGACGAAATCCTGACCCGGTTGCAGAA R: -------A--------------GTACG-----G- (- , identical residue) M: -------G---------------TACG-----G-Hog: GTCATAGCTATTCTGTGTGAATGTATATACATTCACACAGAATAGCTATGAC H: ---------G------------------------------------------S: ------------------------------------------C---------Conclusions. AHR message is expressed in porcine retina. In the eye CYP1A1/1A2 induction is highest in the ciliary epithelium and negligible in the retina (3). Then, the question is: What is AHR doing in the retina?.",
author = "Singh, {A. K.} and Minoru Ko and H. Shichi",
year = "1996",
month = "2",
day = "15",
language = "English",
volume = "37",
journal = "Investigative Ophthalmology and Visual Science",
issn = "0146-0404",
publisher = "Association for Research in Vision and Ophthalmology Inc.",
number = "3",

}

TY - JOUR

T1 - Expression of aryl hydrocarbon receptor mRNA in porcine retina

AU - Singh, A. K.

AU - Ko, Minoru

AU - Shichi, H.

PY - 1996/2/15

Y1 - 1996/2/15

N2 - Purpose. The aryl hydrocarbon receptor (AHR) mediates CYP1A1/1A2 induction by aryl hydrocarbons (e.g. TCDD). AHR proteins are similar to steroid receptors in their mechanism of action but constitute a distinct molecular family (1). In addition to a role in drug metabolism, it was suggested that AHR may regulate the homeostasis and cell differentiation (2). Two Drosophila proteins Sim and Per which are homologous to AHR appear to play roles in neural development and circadian rhythm, respectively. AHR may also have a function in mammalian retina. In this study, therefore, we investigated whether AHR mRNA is expressed in porcine retina. Methods. cDNA was synthesized from porcine retina RNA by RT-PCR using primers designed from mouse AHR cDNA and cloned into pCRTM II vector. DNA was sequenced with SP6 and T7 primers and analyzed by NCBI BLAST Search. Results. From a comparison of 341 bases, the porcine retina PCR product was found to be very similar to AHR from several species [rat (R), mouse (M), human (H), sheep (S)]. Hog: ACATAACGGACGAAATCCTGACCCGGTTGCAGAA R: -------A--------------GTACG-----G- (- , identical residue) M: -------G---------------TACG-----G-Hog: GTCATAGCTATTCTGTGTGAATGTATATACATTCACACAGAATAGCTATGAC H: ---------G------------------------------------------S: ------------------------------------------C---------Conclusions. AHR message is expressed in porcine retina. In the eye CYP1A1/1A2 induction is highest in the ciliary epithelium and negligible in the retina (3). Then, the question is: What is AHR doing in the retina?.

AB - Purpose. The aryl hydrocarbon receptor (AHR) mediates CYP1A1/1A2 induction by aryl hydrocarbons (e.g. TCDD). AHR proteins are similar to steroid receptors in their mechanism of action but constitute a distinct molecular family (1). In addition to a role in drug metabolism, it was suggested that AHR may regulate the homeostasis and cell differentiation (2). Two Drosophila proteins Sim and Per which are homologous to AHR appear to play roles in neural development and circadian rhythm, respectively. AHR may also have a function in mammalian retina. In this study, therefore, we investigated whether AHR mRNA is expressed in porcine retina. Methods. cDNA was synthesized from porcine retina RNA by RT-PCR using primers designed from mouse AHR cDNA and cloned into pCRTM II vector. DNA was sequenced with SP6 and T7 primers and analyzed by NCBI BLAST Search. Results. From a comparison of 341 bases, the porcine retina PCR product was found to be very similar to AHR from several species [rat (R), mouse (M), human (H), sheep (S)]. Hog: ACATAACGGACGAAATCCTGACCCGGTTGCAGAA R: -------A--------------GTACG-----G- (- , identical residue) M: -------G---------------TACG-----G-Hog: GTCATAGCTATTCTGTGTGAATGTATATACATTCACACAGAATAGCTATGAC H: ---------G------------------------------------------S: ------------------------------------------C---------Conclusions. AHR message is expressed in porcine retina. In the eye CYP1A1/1A2 induction is highest in the ciliary epithelium and negligible in the retina (3). Then, the question is: What is AHR doing in the retina?.

UR - http://www.scopus.com/inward/record.url?scp=33750181899&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=33750181899&partnerID=8YFLogxK

M3 - Article

VL - 37

JO - Investigative Ophthalmology and Visual Science

JF - Investigative Ophthalmology and Visual Science

SN - 0146-0404

IS - 3

ER -